Research

(the author of the text comes from outside of Anglosaxon lingual area)

Visualization of numeral systems

Quaternary numeral system

Quaternary numeral system

910, 268, 279, 395, 987, 796, 987, 363, 188, 967, 133, 705, 709, 119, 423, 774, 804, 866, 777, 875, 568, 329, 495, 241, 427, 186, 337, 107, 579, 1002, 720, 480, 668, 775, 513, 967, 240, 490, 191, 887, 806, 298, 67

32032, 10030, 10113, 12023, 33123, 30130, 33123, 11223, 02330, 33013, 02011, 23001, 23011, 01313, 12213, 30012, 30210, 31202, 30021, 31223, 20320, 11021, 13233, 03301, 12223, 02322, 11101, 01223, 21003, 33222, 23100, 13200, 22130, 30013, 20001, 33013, 03300, 13222, 02333, 31313, 30212, 10222, 01003

Recalculating of decimal numeral system to quaternary numeral system:

395, 12023

4^4 + 4^3 + 4^2 + 4^1 + 4^0

256 + 64 + 16 + 4 + 1

1 + 2 + 0 + 2 + 3

256 + 128 + 0 + 8 + 3 (=395)

................................................

Ternary numeral system

Ternary numeral system

34, 158, 217, 39, 233, 161, 234, 202, 137, 88, 53, 177, 44, 222, 71, 157, 118, 233, 138, 53, 9, 200, 237, 92, 156, 57, 67, 46, 209, 173, 163, 110, 22, 16, 225, 134, 8, 143, 55, 89, 122, 11, 126

01021, 12212, 22001, 01110, 22122, 12222, 22200, 21111, 12002, 10021, 01222, 20120, 01122, 22020, 02122, 12211, 11101, 22122, 12010, 01222, 00100, 21102, 22210, 10102, 12210, 02010, 02111, 01201, 21202, 20102, 20001, 11002, 00211, 00121, 22100, 11222, 00022, 12022, 02001, 10022, 11112, 00102, 11200

Recalculating of decimal numeral system to ternary numeral system:

143, 12022

3^4+ 3^3+ 3^2+ 3^1+ 3^0

81 + 27 + 9 + 3 + 1

1 + 2 + 0 + 2 + 2

81 + 54 + 0 + 6 + 2 (=143)

................................................

Quinary numeral system

Quinary numeral system

1029, 1070, 2715, 2857, 18, 53, 942, 1189, 2699, 74, 879, 2627, 395, 2874, 1748, 1962, 299, 511, 2850, 2504, 2177, 840, 320, 2764, 2656, 331, 1768, 749, 103, 444, 2533, 5, 1988, 2111, 2386, 2323, 3076, 1097, 1704, 928, 356, 1601, 1290

13104, 13240, 41330, 42412, 00033, 00203, 12232, 14224, 41244, 00244, 12004, 41002, 03040, 42444, 23443, 30322, 02144, 04021, 42400, 40004, 32202, 11330, 02240, 42024, 41111, 02311, 24033, 10444, 00403, 03234, 40113, 00010, 30423, 31421, 34021, 33243, 44301, 13342, 23304, 12203, 02411, 22401, 20130

Recalculating of decimal numeral system to quinary numeral system:

1704, 23304

5^4+ 5^3+ 5^2+ 5^1+ 5^0

625 + 125 + 25 + 5 + 1

2 + 3 + 3 + 0 + 4

1250 + 375 + 75 + 0 + 4 (=1704)

................................................

Visualization numeral systems application

download Visualization NumeralS application

................................................

Visualization of nucleotide sequence

Sequence of 215 nucleotides x 3

Sequence of 215 nucleotides

TCCAAGAACCTACATGTTCGCGTGTTCAGCGTCCATTTCAGTATTTAGCATAAATTTGAAGAGCCGAATGGCAG TTTTGGGAGGGACACGTTGTTTTAAAAGAAGCCTTCACGAAATTGTGACCGGTCTGGACTGAAAGTACCACGGA TATCTAGCAGAAAACTAAGATTCCGCCAACCTTCTCTGTTTGCCTATGACCAACAGCATCTCAGGGT

CCGGTATGAATTCTCCGCGCAATAAGCCATCTCCCTACCGCATTGCATCAAAGCATTTCACAGCAGTCCAGCCC CGAGGTTCAGGGTCTCGGAGCTTCTGTCGACAGTAACAACCGGGTCGTGCCCGCCATCAATCGGTATCTTAAAT AAATAGAAATCTTTAGAGGCCGGTGGTAATACAGTTAGATCGACATAGTAAATAGGCTCAGAACTA

CTACGTATAAGGCGCTCTGATTGACGAAATGAGAACTAGAGCAGTACCGGGGAGGTCTTGTTAACTACGTTATA GGGAGCGCCCCTGCATTAACCCCCCCTGCGAGCTGTCATAGAAGCCCAATACGTGGACGTACCAATGAAGAGTA ACGACTCTAGTAGCGTCATGTACCACATACCCGTACTCAGACACACACGGGTACGCGATTGAGCACG

................................................

Sequence of 744 nucleotides

Sequence of 215 nucleotides

GCGGCTTCCTACCTTTAGCTCCGAGTATAGTGAGGCCTAGATATGCGCGGGCAGGTAGCTACAGTGTATACATG CTCGTTCTGCGGCATGCGGATATAAATTAAGGATAATACTCAAGTGTTCCAGGGGAGCAGTCATAAAGCACAAC TTCATTATCCCTAAGCTCAGTTAATCTAAGCATGTTTAGCGCTAAGTCTCGTCTACGCGGCAAATACTTTGTAA GCGTTTCTTTAACTTGCCGCTCTCAGAAGGGGCACGGCCGTCATTATGTAACAAGAACGAGTCTCTTACTGGTT GTGCGAGTGGAATGGAGCAACGATGTACGTGTACCGGAAATTTCTAAGGTTTCCCGGCGTATCGATCAAGTCCA GGTTACCGCCTCCCGACAAGGGTATGCTCAACATCCACTGCTGCTGTCCTACGCTCCCTTGGAGACCAATCCTG CGTCATTCAAACTTCGAACATGCGCCGGCATTGTATGTTCATGCCGATAGTGGGTTCATGTTGTGTTATTTACA TTCACTGAGTGGCTTCTGCATGTTTCTGGCTCGCCCGAGACTGATCACGCAAAAAATCTCAGAGATGAACTCAA CTGTACCCGTATAATTGGACCAAAGCTGTCGCGCAGCCGTTACGTGCGTATAGTAAATCCAATTTGCTGCAAAT TCAACAAAAAAGACAGGCTCACGATGCGACGATATTTTGATAATTTTCTAGCGGGCTCGGCCAGCGTACAGTGA GAGTTTACTGGTGGCGGCGCTGCTAACACGAGTT

................................................

Visualization SequencesN application

download Visualization SequencesN application

................................................

Gregory Podgorniak, Poland (2010 numeral systems, 2015 nucleotide sequence)

about the author, My name is Gregory Podgorniak (brn. 01.1977, Szczecinek, West Pomerania, Poland). I am working on field of natural as well as social sciences. During studies at Adam Mickiewicz University in Poznan (1996-1999) I was actively act in student scientific organisation, got a scientific scholarship, and one from my articles titled Circulus vitiosus and fourfold petitio principii in the system of Descartes was published in Humanistic Drafts of Publishing House of Humaniora Foundation in Poznan, no. 6, 1998. Unfortunately certain fate events made impossible to me continuing studies to master's and later doctor's degree (while in Poland there are some age limits for such studies). Thence I was forced to be content only with a title of bachelor.
Thanks to deep and penetrating studies I was able to establish indisputably some number of my past incarnations reaching of ancient period, these data are certain, these incarnations are: Auguste Comte (1798-1857) French philosopher and sociologist, Edme Mariotte (1620-1684) French physicist and meteorologist, Aenesidemus (1 st century BC) Greek sceptical philosopher, Arcesilaus (315-241 BC) Greek sceptical philosopher, Gorgias (485-380 BC) Greek sophist.

email contact: podgorniakgr@gmail.com

see also map of my research

go top



5671