Text

(the author of the text comes from outside of Anglosaxon lingual area)

Visualization of numeral systems

Quaternary numeral system

Quaternary numeral system

910, 268, 279, 395, 987, 796, 987, 363, 188, 967, 133, 705, 709, 119, 423, 774, 804, 866, 777, 875, 568, 329, 495, 241, 427, 186, 337, 107, 579, 1002, 720, 480, 668, 775, 513, 967, 240, 490, 191, 887, 806, 298, 67

32032, 10030, 10113, 12023, 33123, 30130, 33123, 11223, 02330, 33013, 02011, 23001, 23011, 01313, 12213, 30012, 30210, 31202, 30021, 31223, 20320, 11021, 13233, 03301, 12223, 02322, 11101, 01223, 21003, 33222, 23100, 13200, 22130, 30013, 20001, 33013, 03300, 13222, 02333, 31313, 30212, 10222, 01003

Recalculating of decimal numeral system to quaternary numeral system:

395, 12023

4^4 + 4^3 + 4^2 + 4^1 + 4^0

256 + 64 + 16 + 4 + 1

1 + 2 + 0 + 2 + 3

256 + 128 + 0 + 8 + 3 (=395)

................................................

Ternary numeral system

Ternary numeral system

34, 158, 217, 39, 233, 161, 234, 202, 137, 88, 53, 177, 44, 222, 71, 157, 118, 233, 138, 53, 9, 200, 237, 92, 156, 57, 67, 46, 209, 173, 163, 110, 22, 16, 225, 134, 8, 143, 55, 89, 122, 11, 126

01021, 12212, 22001, 01110, 22122, 12222, 22200, 21111, 12002, 10021, 01222, 20120, 01122, 22020, 02122, 12211, 11101, 22122, 12010, 01222, 00100, 21102, 22210, 10102, 12210, 02010, 02111, 01201, 21202, 20102, 20001, 11002, 00211, 00121, 22100, 11222, 00022, 12022, 02001, 10022, 11112, 00102, 11200

Recalculating of decimal numeral system to ternary numeral system:

143, 12022

3^4+ 3^3+ 3^2+ 3^1+ 3^0

81 + 27 + 9 + 3 + 1

1 + 2 + 0 + 2 + 2

81 + 54 + 0 + 6 + 2 (=143)

................................................

Quinary numeral system

Quinary numeral system

1029, 1070, 2715, 2857, 18, 53, 942, 1189, 2699, 74, 879, 2627, 395, 2874, 1748, 1962, 299, 511, 2850, 2504, 2177, 840, 320, 2764, 2656, 331, 1768, 749, 103, 444, 2533, 5, 1988, 2111, 2386, 2323, 3076, 1097, 1704, 928, 356, 1601, 1290

13104, 13240, 41330, 42412, 00033, 00203, 12232, 14224, 41244, 00244, 12004, 41002, 03040, 42444, 23443, 30322, 02144, 04021, 42400, 40004, 32202, 11330, 02240, 42024, 41111, 02311, 24033, 10444, 00403, 03234, 40113, 00010, 30423, 31421, 34021, 33243, 44301, 13342, 23304, 12203, 02411, 22401, 20130

Recalculating of decimal numeral system to quinary numeral system:

1704, 23304

5^4+ 5^3+ 5^2+ 5^1+ 5^0

625 + 125 + 25 + 5 + 1

2 + 3 + 3 + 0 + 4

1250 + 375 + 75 + 0 + 4 (=1704)

................................................

Visualization numeral systems application

download Visualization NumeralS application

................................................

Visualization of sequences of nucleotides

Sequence of 215 nucleotides x 3

Sequence of 215 nucleotides

TCCAAGAACCTACATGTTCGCGTGTTCAGCGTCCATTTCAGTATTTAGCATAAATTTGAAGAGCCGAATGGCAG TTTTGGGAGGGACACGTTGTTTTAAAAGAAGCCTTCACGAAATTGTGACCGGTCTGGACTGAAAGTACCACGGA TATCTAGCAGAAAACTAAGATTCCGCCAACCTTCTCTGTTTGCCTATGACCAACAGCATCTCAGGGT

CCGGTATGAATTCTCCGCGCAATAAGCCATCTCCCTACCGCATTGCATCAAAGCATTTCACAGCAGTCCAGCCC CGAGGTTCAGGGTCTCGGAGCTTCTGTCGACAGTAACAACCGGGTCGTGCCCGCCATCAATCGGTATCTTAAAT AAATAGAAATCTTTAGAGGCCGGTGGTAATACAGTTAGATCGACATAGTAAATAGGCTCAGAACTA

CTACGTATAAGGCGCTCTGATTGACGAAATGAGAACTAGAGCAGTACCGGGGAGGTCTTGTTAACTACGTTATA GGGAGCGCCCCTGCATTAACCCCCCCTGCGAGCTGTCATAGAAGCCCAATACGTGGACGTACCAATGAAGAGTA ACGACTCTAGTAGCGTCATGTACCACATACCCGTACTCAGACACACACGGGTACGCGATTGAGCACG

................................................

Sequence of 744 nucleotides

Sequence of 215 nucleotides

GCGGCTTCCTACCTTTAGCTCCGAGTATAGTGAGGCCTAGATATGCGCGGGCAGGTAGCTACAGTGTATACATG CTCGTTCTGCGGCATGCGGATATAAATTAAGGATAATACTCAAGTGTTCCAGGGGAGCAGTCATAAAGCACAAC TTCATTATCCCTAAGCTCAGTTAATCTAAGCATGTTTAGCGCTAAGTCTCGTCTACGCGGCAAATACTTTGTAA GCGTTTCTTTAACTTGCCGCTCTCAGAAGGGGCACGGCCGTCATTATGTAACAAGAACGAGTCTCTTACTGGTT GTGCGAGTGGAATGGAGCAACGATGTACGTGTACCGGAAATTTCTAAGGTTTCCCGGCGTATCGATCAAGTCCA GGTTACCGCCTCCCGACAAGGGTATGCTCAACATCCACTGCTGCTGTCCTACGCTCCCTTGGAGACCAATCCTG CGTCATTCAAACTTCGAACATGCGCCGGCATTGTATGTTCATGCCGATAGTGGGTTCATGTTGTGTTATTTACA TTCACTGAGTGGCTTCTGCATGTTTCTGGCTCGCCCGAGACTGATCACGCAAAAAATCTCAGAGATGAACTCAA CTGTACCCGTATAATTGGACCAAAGCTGTCGCGCAGCCGTTACGTGCGTATAGTAAATCCAATTTGCTGCAAAT TCAACAAAAAAGACAGGCTCACGATGCGACGATATTTTGATAATTTTCTAGCGGGCTCGGCCAGCGTACAGTGA GAGTTTACTGGTGGCGGCGCTGCTAACACGAGTT

................................................

Visualization SequencesN application

download Visualization SequencesN application

................................................

Gregory Podgorniak, Poland (2010 numeral systems, 2015 sequences of nucleotides)

email contact: podgorniakgr@gmail.com

see also map of my texts

go top



2390