Research

(the author of the text comes from outside of Anglosaxon lingual area)

Visualization of nucleotide sequence

Components of DNA

DNA is a carrier of genetic information. Into its composition enter basic units which we call nucleotides. For their designation we use letters A G C T which indicate separate nucleobases:

A - adenine
G - guanine
C - cytosine
T - thymine

being the one from components of nucleotides besides monosaccharide pentose called deoxyribose and particles of phosphoric acid.

An example of DNA segment: ATCCAAGCGCCCGCTAATTCTGTTCTGTTAATGTTCATACCAAGAACCGGC

................................................

Sequence of 744 nucleotides

Sequence of 215 nucleotides

GCGGCTTCCTACCTTTAGCTCCGAGTATAGTGAGGCCTAGATATGCGCGGGCAGGTAGCTACAGTGTATACATG CTCGTTCTGCGGCATGCGGATATAAATTAAGGATAATACTCAAGTGTTCCAGGGGAGCAGTCATAAAGCACAAC TTCATTATCCCTAAGCTCAGTTAATCTAAGCATGTTTAGCGCTAAGTCTCGTCTACGCGGCAAATACTTTGTAA GCGTTTCTTTAACTTGCCGCTCTCAGAAGGGGCACGGCCGTCATTATGTAACAAGAACGAGTCTCTTACTGGTT GTGCGAGTGGAATGGAGCAACGATGTACGTGTACCGGAAATTTCTAAGGTTTCCCGGCGTATCGATCAAGTCCA GGTTACCGCCTCCCGACAAGGGTATGCTCAACATCCACTGCTGCTGTCCTACGCTCCCTTGGAGACCAATCCTG CGTCATTCAAACTTCGAACATGCGCCGGCATTGTATGTTCATGCCGATAGTGGGTTCATGTTGTGTTATTTACA TTCACTGAGTGGCTTCTGCATGTTTCTGGCTCGCCCGAGACTGATCACGCAAAAAATCTCAGAGATGAACTCAA CTGTACCCGTATAATTGGACCAAAGCTGTCGCGCAGCCGTTACGTGCGTATAGTAAATCCAATTTGCTGCAAAT TCAACAAAAAAGACAGGCTCACGATGCGACGATATTTTGATAATTTTCTAGCGGGCTCGGCCAGCGTACAGTGA GAGTTTACTGGTGGCGGCGCTGCTAACACGAGTT

This type of sequence can be a recording of a single gene - an unit of heredity. For example gene SD17 species Arabidopsis thaliana (thale cress) has a size of 843 nucleotides and is coding Receptor-like serine/threonine-protein kinase SD1-7. Gene ANP3 of the same species has a size of 651 nucleotides and is coding Mitogen-activated protein kinase kinase kinase 3.

................................................

Sequence of 215 nucleotides x 3

Sequence of 215 nucleotides

TCCAAGAACCTACATGTTCGCGTGTTCAGCGTCCATTTCAGTATTTAGCATAAATTTGAAGAGCCGAATGGCAG TTTTGGGAGGGACACGTTGTTTTAAAAGAAGCCTTCACGAAATTGTGACCGGTCTGGACTGAAAGTACCACGGA TATCTAGCAGAAAACTAAGATTCCGCCAACCTTCTCTGTTTGCCTATGACCAACAGCATCTCAGGGT

CCGGTATGAATTCTCCGCGCAATAAGCCATCTCCCTACCGCATTGCATCAAAGCATTTCACAGCAGTCCAGCCC CGAGGTTCAGGGTCTCGGAGCTTCTGTCGACAGTAACAACCGGGTCGTGCCCGCCATCAATCGGTATCTTAAAT AAATAGAAATCTTTAGAGGCCGGTGGTAATACAGTTAGATCGACATAGTAAATAGGCTCAGAACTA

CTACGTATAAGGCGCTCTGATTGACGAAATGAGAACTAGAGCAGTACCGGGGAGGTCTTGTTAACTACGTTATA GGGAGCGCCCCTGCATTAACCCCCCCTGCGAGCTGTCATAGAAGCCCAATACGTGGACGTACCAATGAAGAGTA ACGACTCTAGTAGCGTCATGTACCACATACCCGTACTCAGACACACACGGGTACGCGATTGAGCACG

................................................

Sequence of 5418 nucleotides

DNA sequence - 5418 nucleotides

TACGGCACAGGTCGGTTCAATCCGTTTCCCCGGATCTCACGTCATAGGACCTATGAGTAGGTAGGTCTTAAAAGA TAATGATTCTGAGGGCTATCACAGCATAATTATTTGTTACAGACGACATTCTCATATTTTCCTGCTTTGCAGGAA AGAGTATTGAACCGCTGAGGAATTACCCACGTGTTGCCAGGCAAGAGACGGCCAGGAATCGCCACGGATTGGGCA CATGACGTCGCGGACAACCCAGAATTGTCTTGAGCGATGGTAAGATCTAACCTCACTGCCGGGGGAGGCTCATAC CTGGGGCTTTACTGATGTCATACCGTCTTGCACGGGGATAGAATGACGGTGCCCGTGTCTGCTTGCCTCGAAGCA ATTTTCTGAAAGTTACAGACTTCGATTAAAAAGATCGGACTGCGCGTGGGCCCGGAGAGACATGCGTGGTAGTCA TTTTTCGACGTGTCAAGGACTCAAGGGAATAGTTTGGCGGGAGCGTTACAGCTTCAATTCCCAAAGGTCGCAAGA CGATAAAATTCAACTACTGGTTTCGGCCTAATAGGTCACGTTTTATGTGAAATAGAGGGGAACCGGCTCCCAAAT CCCTGGGTGTTCTATGATAAGTCCTGCTTTATAACACGGGGCGGTTAGGTTAAATGACTCTTCTATCTTATGGTG ATCCAAGCGCCCGCTAATTCTGTTCTGTTAATGTTCATACCAATACTCACATCACATTAGATCAAAGGATCCCCG AGCCCAGTCGCAAGGGTCTGCTGCTGTTGTCGACGCCTCATGTTACTCCTGGAATCTACCTGCCCTCCCCTCACC GGTTAAGGCGTGTGATCGACGATGCAGGTATACATCGGCTCGGACCTACAGTGGTCGATCGACTGGCTACTGGCT TCGCGGTTCGGCGCGTAGTTGAGTGCGATAACCCAACCGGTGGCAAGTAGCAAGAAGACCTACCTGGGTCACCTT AGACAACCTAACTAATAGTCTCTAACGGGGAATTACCTTTACCAGTCTCATGCCTCCAATATATCTGCACCGCTT CAATGATATCGCCCACAGAAAGTAGGGTCTCAGGTATCGCATACGCCGCGCCCGGGTCCCAGCTACGCTCAGGAC GACAGTAGAGAGCTATTGTGTAATTCAGGCTCAGCATTCATCGACCTTTCCTGTTGTGAATATTGTGCTAATGCA TCTCGTCCGTAACGATCTGGGGGGCAAAACCGAATATCCGTATTCTCGTCCTACGGGTCCACAATGAGAAAGTCC TGCGCGTGATCGTCAGTTAAGTTAAATTAATTCAGGCTACGGTAAACTTGTAGTGAGCTAAGAATCACGGGAATC ACGGGTTCGCTACAGATGAACTGAATTTATACACGGACAACTCATCGCCCATTTGGGCGTGGGCACCGCAGATCA AAAGTGGCAGATTAGGAGTGCTTGATCAGGTTAGCAGGTGGACTGTATCCAACAGCGCATCAAACTTCAATAAAT CCAAAGCGTTGTAGTGGTCTAAGCACCCCTGAACAGTGGCGCCCATCGTTAGCGTAGTACAACCCTTCCCCCTTG AGGTGCGACATGGGGCCAGTTAGCCTGCCCTATATCCCTTGCACACGTTCAATAAGAGGGGCTCTACAGCGCCGC TTTTTAAATTAGGATGCCGACCCCATCATTGGTAACTGTATGTTCATAGATATTTCTTCAGGAGTAATAGCGACA AGCTGACACGCAAGGGTCAACAATAATTTCTACTATCACCCCGCTGAACGACTGTCTTTGCAAGAACCAACTGGG CTTAGATTCGCGTCCTAACGTAGTGAGGGCCGAGTCATATCATAGATCAGGCATGAGAAACCGACGTCGAGTCTA CACACGAGTTGTAAACAACTTGATTGCTATACTGTAGCTACCGCAAGGATCTCCTACATCAAAGACTACTGGGCG ATCTGGATCCGAGTCAGAAATACGAGTTAATGCAAATTTACGTAGACCGGTGAAAACACGTGCCATGGGTTGCGT AGACCGTAGTCAGAAGTGTGGCGCGCTATTCGTACCGAACCGGTGGAGTATACAGAATTGCTCTTCTACGACGTA AGGAGCTCGGTCCCCAATGCACGCCAAAAAAGGAATAAAGTATTCAAACTGCGCATGGTCCCTCCGCCGGTGGCA CTATTATCCATCCGAACGTTGAACCTACTTCCTCGGCTTATGCTGTCCTCAACAGTATCGCTTATGAATCGCATG CGGCTGTGGATCTTAACGGCCACATTCTTAATTCCGACCGATCACCGATCGCCTTTCCTCGCTGGTACAATGAGT ACTAAGTTATCCAGATCAAGGTTTGAACGGACTCGTATGACATGTGTGACTGAACCCGGGAGGAAATGCAGAGAA CTGTTTCAAGGCCTCTGCTTTGGTATCACTCAATATATTCAGACCAGACAAGTGGCAAAATTTCGTGCGCCTCTC CTAGGTATTCACGCAACCGTCGTAACATGCACTAAGGATAACTAGCGCCAGGGGGGCATACTAGGTCCCGGAGCT AAAGACTACCCTATGGATTCCTTGGAGCGGGGACAATGCAGACCGGTTACGACACAATTATCGGGATCGTCTAGA GGTATTATTAGCAAGACAATAAAGGACATTGCACAGAGACTTATTAGAATTCAACAAACAGGATCATATCATGCG GTGTTGGGTCGGGCAAGTCCCCGAAGCTCGGCCAAAAGATTCGCCATGGAACCGTCTGGTCCTGTTAGCGTGTAC GCCTGCTCCTGTTCCGGGTACCATAGATAGACTGAGATTGCGTCAAAAAATTGCGGCGAAAATAGAGGGGCTCCT TGTAGAAATACCAGACTGGGGAATTTAAGCGCTTTCCACTATCTGAGCGACTAAACATCAACAAATGCGTCTACT CGAATCCGCAGTAGGCAATTACAACCTGGTTCAGATCACTGGTTAATCAGGGATGTCTTCATAAGATTATACTTG CCCCGACGCGACAGCTCTTCAAGGGGCCGATTTTTGGACTTCAGATACGCTAGAATTTAAAGGGTCTCTTACACC TGCTGCGGCCTGCAGGGACCCCTAGAACTTGCCGCCTACTTGTCTCAGTCTAATAACGCGCGAAGCCGTGGGGCA CGTGACCTTAAGTCGCAGAGCGAGTGATGAATTTGGGACGCTAATATGGGTGAATAGAGACTTATATCATCAGGG CATGAACACTGTCTAGAAGATAAGCCCTAGGTTTCCTTCTCAAGGCATGGTCGTGTTACCGTATGTGCGCTCTAA AACAACCGATCGCATGTGGGCGGGGACGTAAAGGCAATGTAAAAGCGAAGGACTGTCTGAGTGCAAAACGCAAAC TACATTCCATGTTTACACCGCGAACTATCCACGCACTATGGTTCCCTTTTCACTGATTGTGCCGAGTATAGAGTA CCTCGAGAACGGAAACTTGTCTGAACGCCATGATCGTAATAGCGGTCGAAAAAAGGGACATAAAAGATCCCTCAT TGAAGACTAGATAGCATACAGGTGTAACAAACCGATACACCTAAACGTGTGGGCAGAATTTCTCATTCCCCACCG CAGGGACGGAACTCCGTTCGAAATTAACATACCGCATGTCGCGTGTTCAAAGGGAGCACATCCTAACCCACCTAT CCTACCCGGTTGCAACCCCGAACCTCAACTGAATGGCGATCAACGCTTCGTTAGCCGCTCACGTGTGGCGGGAGA GGATCGCCCAACTTTGGAAGACCTGTCTCTGTGCGCTCTATACTCCTAGGTTTATTCAATGCGCCAAAAACCATC GGCACGTACGATTAAACGACGAGCCCGACGGGGAACCTTTAAGCCATCCTTGTTATTGCAGTAGCTCAGTACTTG CACGTGATGGGGCGCGTACACTGGAGACACGTCTTGATATTTAAACCTTGCTCCAGCCCGGCTACAGCAGAAGAC CGCAACAGTCGTGCTGACCAGTTAGAAAGATGATATGTGCGCAGCTTTTAACAGGGTGCCCCGTGGAACAGTCCT GTCGACTACAAAGGATGCGTTATCAGTCCCACCATCTCAGCGTGTTCGCCCATTACTAAGCTACACGGCGCAATA GCGGGGGACGCGCCGCCCCCCGATAACGATCATGTTGGGTAGGGACAGTCACAACGGTCTCCTGTTTACTAACAA TTCATGTCAACACGCCATCTTACATGGTGTGACTGTCTAAGGGGCGGGCGGTTTCCTACAACTCCGAAGTAATTC CCTCTGTCAGTATCACAGATGCCAAAGAATTCTATCTGAACCAGCACAGCTAAAATACATGCTCCGTAGGCCACT TTCGCAAATCCAAATGCGATAATTTATCTTAAGACTGCATCTGCAAACCCAGGCCCGGGGTGATAGCTCTCATCT GAATATAACGTGTGCCAAAGCGCGTGGCCGAGCTCATTTCAAGCCAACATTCGCATGTCGTGGAAGTTCGTCACC AGGCCATAGATACTTACATAAGCCGGAAAGTACACCATCAGGCGAGCTAGTCATCACGGTTACTGGGGATTCATG CGTGGCGACTGTTCCAAAAGTTGCCATACGGCAGGACCTTTTATTTTCTGGTACAGACGTCACCGCAATCTTCTA ACTACTAACGGCGCTAAAACTCTGCGCAAGTCAGTTGGGTCTTTCTATGATATAACATGTCGTAACTGACATTAA GAGTTGCGCGTATAACTGCGAATAGACTGCATAGCTCGTCCTAGAACTATCATGGTGTACGGCATCGCTCTGACA CTTATTATTCTTGGCTCTGGCTTAATATCCCCGTCGATCCCAGCGTCTCCAAGTCGTACTTCCGTGGTTGTCATC TCATTCCCAGAGTGCGGGTCAGCGAATATCTTACGTACCCCTGCCGAAGTCGTACCCCCGAGCTTCGGTATCTCA TATAGTGTCGGCGGCACGACTGGGCTCGGGAGCTCGGAAGTTGGATAAATCATATGTGACGAGTCCAGAAAGTTC AGTATAGCCTTGGTGTTTCCAATGGTTCTCATGTCGTGGCCGAAGTCGAGCTCCTCTTAGCCCGCAGGAACAAAC GAGGGCTACGTACAGGGTTGTCAGTGTAATTAAAGTATCGCCGAGACTCTAGTCGGCAGAGAAACCAGTTGGCCT GTTCCCTTCTCTACCCGACCCTCTTACTTGTGATAATATGTACAAATTACCCGGAAAATAGAGTCGCAAATCAGA CGGCAGAAGTCGTAGTATCAGTTTATTTATTTTATCATTGACTCTGGCCGTAGTACTTTTTCGTCGGTTACCCCC TGCTGATCCTGAAACGAACCCACACGAAAGTTCTAGCGAAACAGCGGATCTGCGCCCCGTTTTGGGTACGGTGTA ATTGTACGCCTGAACTGA

This type of sequence can be a recording of some number of genes.

................................................

Visualization SequencesN application

download Visualization SequencesN application

................................................

Visualization of numeral systems

Quaternary numeral system

Quaternary numeral system

910, 268, 279, 395, 987, 796, 987, 363, 188, 967, 133, 705, 709, 119, 423, 774, 804, 866, 777, 875, 568, 329, 495, 241, 427, 186, 337, 107, 579, 1002, 720, 480, 668, 775, 513, 967, 240, 490, 191, 887, 806, 298, 67

32032, 10030, 10113, 12023, 33123, 30130, 33123, 11223, 02330, 33013, 02011, 23001, 23011, 01313, 12213, 30012, 30210, 31202, 30021, 31223, 20320, 11021, 13233, 03301, 12223, 02322, 11101, 01223, 21003, 33222, 23100, 13200, 22130, 30013, 20001, 33013, 03300, 13222, 02333, 31313, 30212, 10222, 01003

Recalculating of decimal numeral system to quaternary numeral system:

395, 12023

4^4 + 4^3 + 4^2 + 4^1 + 4^0

256 + 64 + 16 + 4 + 1

1 + 2 + 0 + 2 + 3

256 + 128 + 0 + 8 + 3 (=395)

................................................

Ternary numeral system

Ternary numeral system

34, 158, 217, 39, 233, 161, 234, 202, 137, 88, 53, 177, 44, 222, 71, 157, 118, 233, 138, 53, 9, 200, 237, 92, 156, 57, 67, 46, 209, 173, 163, 110, 22, 16, 225, 134, 8, 143, 55, 89, 122, 11, 126

01021, 12212, 22001, 01110, 22122, 12222, 22200, 21111, 12002, 10021, 01222, 20120, 01122, 22020, 02122, 12211, 11101, 22122, 12010, 01222, 00100, 21102, 22210, 10102, 12210, 02010, 02111, 01201, 21202, 20102, 20001, 11002, 00211, 00121, 22100, 11222, 00022, 12022, 02001, 10022, 11112, 00102, 11200

Recalculating of decimal numeral system to ternary numeral system:

143, 12022

3^4+ 3^3+ 3^2+ 3^1+ 3^0

81 + 27 + 9 + 3 + 1

1 + 2 + 0 + 2 + 2

81 + 54 + 0 + 6 + 2 (=143)

................................................

Quinary numeral system

Quinary numeral system

1029, 1070, 2715, 2857, 18, 53, 942, 1189, 2699, 74, 879, 2627, 395, 2874, 1748, 1962, 299, 511, 2850, 2504, 2177, 840, 320, 2764, 2656, 331, 1768, 749, 103, 444, 2533, 5, 1988, 2111, 2386, 2323, 3076, 1097, 1704, 928, 356, 1601, 1290

13104, 13240, 41330, 42412, 00033, 00203, 12232, 14224, 41244, 00244, 12004, 41002, 03040, 42444, 23443, 30322, 02144, 04021, 42400, 40004, 32202, 11330, 02240, 42024, 41111, 02311, 24033, 10444, 00403, 03234, 40113, 00010, 30423, 31421, 34021, 33243, 44301, 13342, 23304, 12203, 02411, 22401, 20130

Recalculating of decimal numeral system to quinary numeral system:

1704, 23304

5^4+ 5^3+ 5^2+ 5^1+ 5^0

625 + 125 + 25 + 5 + 1

2 + 3 + 3 + 0 + 4

1250 + 375 + 75 + 0 + 4 (=1704)

................................................

Visualization numeral systems application

download Visualization NumeralS application

................................................

Gregory Podgorniak, Poland (2015 nucleotide sequence, 2010 numeral systems)

Comte's Theory of Science

Comte's Theory of Science

According to him whole of sciences consists of theoretical and applied knowledge. Theoretical knowledge divide on general as physics or biology, which are an object of his research and detailed such as botany, zoology or mineralogy. Main fields mathematics, astronomy, physics, chemistry, biology and sociology it is possible to order according to decrescent range of research and complicatedness of theoretical tools what is connected with growing complexity of investigated phenomenones. Following sciences are based on previous, for example to methodically coll chemistry, we must imply acquaintance of physics, because all chemical phenomena are more complicated than physical phenomena, are also from them dependent and themselves do not have on them an influence. Similarly sciences classified as earlier, are older and more advanced from these which are presented as later. This theory is clearly analogous to Mariotte's Law.

Mariotte's Law

Edme Mariotte (1620-1684) French physicist, meteorologist, physiologist. He initiated meteorological research and measurement. In his Discourse on the Nature of Air (1676) coined the word barometer and formulate basic tenet of physics called Mariotte's law states that at constant temperature T volume V of a given quantity of gas is inversely proportional as its pressure p:

pV = constant

its graph is hyperbole:

pV = const = nrT

p = rT / V

Mariotte's Law'

about the author, My name is Gregory Podgorniak (brn. 01.1977, Szczecinek, West Pomerania, Poland). I am working on field of natural as well as social sciences. During studies at Adam Mickiewicz University in Poznan (1996-1999) I was actively act in student scientific organisation, got a scientific scholarship, and one from my articles titled Circulus vitiosus and fourfold petitio principii in the system of Descartes was published in Humanistic Drafts of Publishing House of Humaniora Foundation in Poznan, no. 6, 1998. Unfortunately certain fate events made impossible to me continuing studies to master's and later doctor's degree (while in Poland there are some age limits for such studies). Thence I was forced to be content only with a title of bachelor.
Thanks to deep and penetrating researchings I was able to establish indisputably some number of my past incarnations reaching of ancient period, these data are certain, these incarnations are: Auguste Comte (1798-1857) French philosopher and sociologist, Edme Mariotte (1620-1684) French physicist and meteorologist, Aenesidemus (1 st century BC) Greek sceptical philosopher, Arcesilaus (315-241 BC) Greek sceptical philosopher, Gorgias (485-380 BC) Greek sophist.

email contact: podgorniakgr@gmail.com

map of my research



7377